XVI International Botanical Congess

Acacia nilotica, A. Senegal, and A. Tortilis are important dry zone tree species and widely distributed in Africa. They are an invaluable source of forage and fuelwood with considerable agroforestry potential. We provide an estimate of genetic differentiation within and between natural populations of the three species based on trnL intron sequence data. The sequences were obtained by direct sequencing of PCR products from four genotypes of each species drawn from two populations in Kenya. The trnL intron was amplified using the universal primers 'c' (CGAAATCGGTAGACGCTACG) and 'd' (GGGGATAGAGGGACTTGAAC) (Taberlet et al., 1991). Mean genetic distrances were relatively higher between than within populations. The data revealed close genetic relationship between A. nilotica and A. tortilis and thus supported the morphological classification. Implications of the genetic variations for conservation of the species are discussed.